Journal:

Article Title: Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains

doi: 10.1128/AAC.46.4.1147-1152.2002

Figure Lengend Snippet: Structure of the SCCmec elements identified from C-MRSA strains in comparison with the three types of SCCmec elements. (A) Type I SCCmec carried by NCTC 10442. (B) Type IV SCCmec carried by strain CA05 (subtype a). (C) Type IV SCCmec carried by strain 8/6-3P (subtype b). (D) Type II SCCmec carried by N315. (E) Type III SCCmec carried by 85/2082. The ORFs of greater than 200 nucleotides in six possible reading frames of type IV SCCmec elements are illustrated in the squares under the bars that represent essential genes and restriction sites for HindIII and XbaI. Differences in coloration correspond to differences in the nucleotide sequences. Color codes are as follows: white, ORFs or the parts of ORFs that are conserved in all four types of SCCmec elements with greater than 99% amino acid identities; gray, ORFs or the parts of ORFs that are conserved in four types of SCCmec with amino acid identities of 46 to 98%; magenta, ORFs or the parts of ORFs that are common to type I and type II SCCmec elements; yellow, ORFs or the parts of ORFs that are common to type II and type III SCCmec elements; blue, ORFs or the parts of ORFs that are unique to type I SCCmec; red, ORFs or the parts of ORFs that are unique to type II SCCmec; green, ORFs or the parts of ORFs that are unique to type III SCCmec, light green, ORFs or the parts of ORFs that are unique to type IVa SCCmec; and orange, ORFs or the parts of ORFs that are unique to type IVb SCCmec. The locations of primers used for amplification of the type IV SCCmec are indicated by arrows: they are primers α5 (5′-TGTTAAGTATATTGCACTTTATGATTCAATGCCT-3′), cLs1 (5′-TGCCAATCACAGTTCAATCAATT-3′), α6 (5′-ATTAGCCGATTTGGTAATTGAA-3′), mCR8 (5′-ATATTCCCGTATGAAAAACAGGACTTGAACTTGCA-3′), and CL2b (ATATTCCCGATAGAAAAACAGGACTTGAACTTGCA) and previously described primers is4, mA2, mA3, and cR1 (11, 12, 14). The entire nucleotide sequences of the type IV SCCmec elements are available in the DDBJ/EMBL/GenBank databases under accession no. AB063172 (subtype a) and AB063173 (subtype b). H, HindIII, X, XbaI; E, EcoRI; P, Pst1.

Article Snippet: In fact, as shown in Table , the two strains were susceptible to all the non-β-lactam antibiotics tested. table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Strain Type of SCC mec MIC (mg/liter) a Oxacillin Ampicillin Ceftizoxime Imipenem Erythromycin Tobramycin Kanamycin Tetracycline CA05 IV 8 32 128 0.125 0.5 0.25 2 0.125 8/6-3P IV 8 16 128 0.125 0.125 0.125 1 0.125 NCTC 10442 I 256 256 >512 16 0.125 0.125 1 128 N315 II 16 32 16 1 >512 512 >512 0.125 85/2082 III 32 32 >512 0.5 >512 8 512 128 ATCC 29213 b 0.25 0.5 4 0.03 0.125 0.25 1 0.125 Open in a separate window a The MICs were determined by the agar plate dilution method of the NCCLS. b A methicillin-susceptible S. aureus type strain.

Techniques: Amplification

Journal:

Article Title: Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains

doi: 10.1128/AAC.46.4.1147-1152.2002

Figure Lengend Snippet: Chromosome-SCCmec junction sequences of type IV SCCmec. The nucleotide sequences around the left and right boundaries of the SCCmec elements of CA05 and 8/6-3P are aligned with those of type II SCCmec. Thin arrows indicate inverted repeats IR-L and IR-R at both extremities of SCCmec elements. Thick arrows indicate direct repeats DRscc-L and DRscc-R.

Article Snippet: In fact, as shown in Table , the two strains were susceptible to all the non-β-lactam antibiotics tested. table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Strain Type of SCC mec MIC (mg/liter) a Oxacillin Ampicillin Ceftizoxime Imipenem Erythromycin Tobramycin Kanamycin Tetracycline CA05 IV 8 32 128 0.125 0.5 0.25 2 0.125 8/6-3P IV 8 16 128 0.125 0.125 0.125 1 0.125 NCTC 10442 I 256 256 >512 16 0.125 0.125 1 128 N315 II 16 32 16 1 >512 512 >512 0.125 85/2082 III 32 32 >512 0.5 >512 8 512 128 ATCC 29213 b 0.25 0.5 4 0.03 0.125 0.25 1 0.125 Open in a separate window a The MICs were determined by the agar plate dilution method of the NCCLS. b A methicillin-susceptible S. aureus type strain.

Techniques:

Journal:

Article Title: Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains

doi: 10.1128/AAC.46.4.1147-1152.2002

Figure Lengend Snippet: ORFs in SCC mec ’s of CA05 and 8/6-3P

Article Snippet: In fact, as shown in Table , the two strains were susceptible to all the non-β-lactam antibiotics tested. table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Strain Type of SCC mec MIC (mg/liter) a Oxacillin Ampicillin Ceftizoxime Imipenem Erythromycin Tobramycin Kanamycin Tetracycline CA05 IV 8 32 128 0.125 0.5 0.25 2 0.125 8/6-3P IV 8 16 128 0.125 0.125 0.125 1 0.125 NCTC 10442 I 256 256 >512 16 0.125 0.125 1 128 N315 II 16 32 16 1 >512 512 >512 0.125 85/2082 III 32 32 >512 0.5 >512 8 512 128 ATCC 29213 b 0.25 0.5 4 0.03 0.125 0.25 1 0.125 Open in a separate window a The MICs were determined by the agar plate dilution method of the NCCLS. b A methicillin-susceptible S. aureus type strain.

Techniques: Sequencing

Journal:

Article Title: Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains

doi: 10.1128/AAC.46.4.1147-1152.2002

Figure Lengend Snippet: Antibiotic susceptibility profiles of the two C-MRSA strains in comparison with those of H-MRSA strains

Article Snippet: In fact, as shown in Table , the two strains were susceptible to all the non-β-lactam antibiotics tested. table ft1 table-wrap mode="anchored" t5 TABLE 2. caption a7 Strain Type of SCC mec MIC (mg/liter) a Oxacillin Ampicillin Ceftizoxime Imipenem Erythromycin Tobramycin Kanamycin Tetracycline CA05 IV 8 32 128 0.125 0.5 0.25 2 0.125 8/6-3P IV 8 16 128 0.125 0.125 0.125 1 0.125 NCTC 10442 I 256 256 >512 16 0.125 0.125 1 128 N315 II 16 32 16 1 >512 512 >512 0.125 85/2082 III 32 32 >512 0.5 >512 8 512 128 ATCC 29213 b 0.25 0.5 4 0.03 0.125 0.25 1 0.125 Open in a separate window a The MICs were determined by the agar plate dilution method of the NCCLS. b A methicillin-susceptible S. aureus type strain.

Techniques:

Journal:

Article Title: Characterization of an Endoprotease (PrpL) Encoded by a PvdS-Regulated Gene in Pseudomonas aeruginosa

doi: 10.1128/IAI.69.9.5385-5394.2001

Figure Lengend Snippet: Strains, plasmids, and primers used in this study

Article Snippet: Laboratory collection S21, S22, S28, S38, S40, S41, S44, S47, S52 CF isolates from British Columbia's Children's Hospital and Shaughnessy Hospital, Vancouver, British Columbia, Canada 22 B15, B16, B22, B31, B34, B35, B38, B43, B44, B47, B48, B51 Blood isolates from Nagasaki University Hospital, Nagasaki, Japan 22 ccu1-6, ccu-7, ccu-8 Environmental strains from Horry and Georgetown Counties in South Carolina 16 P. putida PPG1 Prototroph Laboratory collection E. coli DH5α hsdR recA lacZYA φ80 lacZ ΔM15 Gibco BRL HB101 hsdS recA proA lacY 4 SM10 Km r , mobilizer strain 47 Plasmids pBluescript SK(+) Amp r lacZ, E. coli cloning vector Stratagene pCRII-2.1 Amp r Km r , TA cloning vector for PCR products Invitrogen pEX100T Amp r oriT mob sacB 46 pEX100 DprpL :: Gm pEX100T containing Δ prpL :: Gm This study pRK2013 Km r , conjugation helper plasmid 17 pVLT31 Broad-host-range expression vector, Tet r 9 pPVD31 pVLT31 containing pvdS under tac promoter control, Tet r 33 Primers b PJW3 TGGAAACCCACAGCGGCTCGCTG; internal to prpL Gibco BRL PJW4 GTACTTCTTGGCGTCGCCGCGCC; internal to prpL Gibco BRL PJW17 ATTTCGCTCGCACCGGGC; flanking prpL promoter Gibco BRL PJW19 CCACGTCAGCGGCAAGCT; flanking prpL promoter Gibco BRL Open in a separate window a Abbreviations: Amp r , ampicillin resistance; Km r , kanamycin resistance; Tet r , tetracycline resistance; mob , mobilization site; oriT , origin of transfer (RK2). b All primers were synthesized by Gibco Bethesda Research Laboratories (BRL).

Techniques: Plasmid Preparation, Clone Assay, TA Cloning, Conjugation Assay, Expressing

Journal:

Article Title: Characterization of Saa, a Novel Autoagglutinating Adhesin Produced by Locus of Enterocyte Effacement-Negative Shiga-Toxigenic Escherichia coli Strains That Are Virulent for Humans

doi: 10.1128/IAI.69.11.6999-7009.2001

Figure Lengend Snippet: Adherence of E. coli JM109 expressing cloned saa genes to HEp-2 cells (Giemsa stain). (A) E. coli JM109:pBluescript; (B) JM109:pJCP563; (C) JM109:pJCP564; (D) JM109:pJCP565.

Article Snippet: The phagemids pBluescript SK (encoding ampicillin resistance) and pBC SK (encoding chloramphenicol resistance) were obtained from Stratagene, La Jolla, Calif. All cells of E. coli strains were routinely grown in Luria-Bertani (LB) medium ( 19 ) with or without 1.5% Bacto-Agar (Difco Laboratories, Detroit, Mich.).

Techniques: Expressing, Clone Assay, Giemsa Stain

Journal:

Article Title: Contributions of MexAB-OprM and an EmrE Homolog to Intrinsic Resistance of Pseudomonas aeruginosa to Aminoglycosides and Dyes

doi: 10.1128/AAC.47.1.27-33.2003

Figure Lengend Snippet: P. aeruginosa strains and plasmids used in this study

Article Snippet: In the ethidium bromide accumulation experiments, M63 minimal medium [13.6 g of KH 2 PO 4 , 2 g of (NH 4 ) 2 SO 4 , and 0.5 mg of FeSO 4 per liter; pH 7.0] supplemented with glucose (0.2%) and MgSO 4 (10 mM) was used. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 P. aeruginosa strain or plasmid Description Source or reference P. aeruginosa PAO1 Prototroph 10 HN1112 Spontaneous streptomycin-resistant ( rpsL ) derivative of PAO1 This study HN1113 HN1112 Δ emrE This study K1119 PAO1 Δ mexAB-oprM 9 HN1114 Spontaneous streptomycin-resistant ( rpsL ) derivative of K1119 This study HN1115 HN1113 Δ mexAB-oprM This study K1589 Spontaneous streptomycin-resistant ( rpsL ) derivative of PAO1 made Δ mexR Δ mexB K. Poole HN1116 K1589 Δ emrE This study Plasmids pEX18Tc Broad-host-range gene replacement vector; sacB, tetracycline resistant 4 pXZL1307 pEX18Tc::Δ emrE This study pELCT04 pK18mob sacB ::ΩHg r and Δ mexAB-oprM, kanamycin and HgCl 2 resistant 9 pBluescript II SK(+) Cloning vector, ampicillin resistant Stratagene pXZL1582 pBluescript II SK(+):: emrE Pae This study Open in a separate window P. aeruginosa strains and plasmids used in this study Plasmids were maintained in E. coli with appropriate selection [pEX18Tc, 10 μg of tetracycline per ml; pECLT04, 50 μg of kanamycin per ml or 15 μg of HgCl 2 per ml; and pBluescript II SK(+), 100 μg of ampicillin per ml].

Techniques: Plasmid Preparation, Clone Assay